Message 2003-03-0004: Re: Fwd: Animal 'bar codes' to take over from Latin names

Sun, 09 Mar 2003 09:22:11 -0800 (PST)

[Previous by date - Re: Note 9.4.1]
[Next by date - Re: Animal 'bar codes' to take over from Latin names]
[Previous by subject - Re: Fw: languages in PhyloCode]
[Next by subject - Re: Fwd: Gender of species names?]

Date: Sun, 09 Mar 2003 09:22:11 -0800 (PST)
From: "Jaime A. Headden" <qilongia@yahoo.com>
To: List PhyloCode <PhyloCode@ouvaxa.cats.ohiou.edu>
Subject: Re: Fwd: Animal 'bar codes' to take over from Latin names

Posted from the Dinosaur Mailing List (my reply to follow):

--- Ronald Orenstein <ornstn@rogers.com> wrote:
> Well, this should be fun for palaeontologists....
> 
> 
> >--------------------------------------
> >Animal 'bar codes' to take over from Latin names
> >By Roger Dobson, Independent.co.uk
> >March 9 2003
> >
> >The names don't exactly trip off the tongue. But the official Latin 
> >monikers used to catalogue the world's animal species are about to be 
> >replaced  with the sort of bar code normally seen on a baked bean tin.
> >
> >For the past two and a half centuries, scientists examining new species
> 
> >have allocated them to the right family with a description based on a 
> >Latin root  making sure, of course, not to confuse an Arbitrarus 
> >conventicus with a Revisionus conventicus  and also carefully
> catalogued 
> >them according to their appearance.
> >
> >But there are fewer and fewer people able to do this work, and it is
> also 
> >painfully slow. Over the past 250 years, only a modest 1.2 million
> species 
> >have been described and named. With an estimated 10 million animal
> species 
> >still to be recorded, there are fears that many could disappear before 
> >they are properly catalogued.
> >
> >Today 40 leading scientists involved in taxonomy  the classification
> of 
> >organisms  will meet in New York with the aim of setting up an 
> >international bar-coding system using individual DNA as labels for new 
> >species. Existing species will get their own bar code, too.
> >
> >With the right technology, says a report co-authored by scientists at
> the 
> >Natural History Museum, in London, up to 1,000 species a day could be
> bar 
> >coded by just one institution. And that, say scientists, will make it 
> >possible to catalogue animal life on the planet within two decades,
> 1,000 
> >or so years sooner than under the current system.
> >
> >Scientists say that the retail industry's coding system employs 10
> digits 
> >to create 100 billion different combinations, or bar codes, that are in
> 
> >turn allocated to specific products ranging from canned beans to
> electronics.
> >
> >DNA is also encoded, using four chemical bases  adenine (A), cytosine 
> >(C), guanine (G) and thymine (T)  and the genomes of most species are 
> >millions of these nucleotides long. The sequence for every living
> organism 
> >is different, and just using a fraction of the sequence would provide
> more 
> >than one billion bar code options.
> >
> >Although new species may have a bar code only, existing species will
> keep 
> >their Latin names too. The bar code for an African elephant (Loxodonta 
> >africana), for example, would be made up of thick and thin lines 
> >representing the four chemical bases using the letters 
> >AACACTGTATCTATTATTTG, while the domestic cat would be
> TACTCTTTACCTTTTATTCG.
> >
> >"The proper naming of species has become a serious bottleneck," says 
> >Professor Paul Hebert, of the University of Guelph, in Canada, who will
> be 
> >at today's meeting. "I do think it is a serious problem, and I believe
> the 
> >move to DNA-based taxonomy will lead to a new approach to the
> description 
> >of species. After the bar coding, those who then want to name and
> describe 
> >species can come along over the next 2,000 years or so  because that's
> 
> >how long it would take  and do so. What we are saying is that there is
> a 
> >need to bring modern technology to the task of species recognition. We 
> >also suggest that nature has been kind enough to embed every life form 
> >with a 'bar code' and all we need to do is read it."
> >
> >Dr Richard Thomas, of the Natural History Museum, and co-author of a 
> >report published this week in Trends in Ecology and Evolution, said:
> "We 
> >think DNA will be very useful for groups of species that have a lot of 
> >diversity in them. With the use of DNA, a species could be described
> and 
> >catalogued. Some groups suggest that a DNA bar code would be
> sufficient, 
> >but I believe that we would still want to come back and name them, 
> >possibly at a later date.
> >
> >"Another advantage of bar codes is that the information is digital and
> not 
> >influenced by subjective assessments. It would be reproducible at any
> time 
> >and by any person, speaking any language."
> >
> >The report reveals the speed with which bar coding  illustrated above
> in 
> >mock-up form for a polar bear and an African elephant  could be done.
> >
> >The report states: "Establishment of a DNA facility that could
> routinely 
> >handle 1,000 samples per day would cost approximately as much as a 
> >facility that runs a transmission and a scanning electron microscope.
> The 
> >material costs for each sample, including DNA extraction and sequencing
> of 
> >two independent regions, would be five euros per sample."
> >
> >Just what Darwin would make of it is not clear, but Dr Thomas believes
> he 
> >would be in favour: "I think he would really love it," he said.
> --
> Ronald I. Orenstein                           Phone: (905) 820-7886
> International Wildlife Coalition              Fax/Modem: (905) 569-0116
> 1825 Shady Creek Court
> Mississauga, Ontario, Canada L5L 3W2          mailto:ornstn@rogers.com

  And this is better how? Please, as for the subjectivity test, there are
things called double-blind or Chinese Curtain tests, you know. How will
this affect the nomenclature and reference struture of fossil species
without DNA or taxa with incomplete DNA? I hope these guys know what the
ramifications of their little system involves. I'll check out the current
TREE at the college this afternoon. This should be most interesting....

  Cheers,

=====
Jaime A. Headden

  Little steps are often the hardest to take.  We are too used to making leaps in the face of adversity, that a simple skip is so hard to do.  We should all learn to walk soft, walk small, see the world around us rather than zoom by it.

"Innocent, unbiased observation is a myth." --- P.B. Medawar (1969)

__________________________________________________
Do you Yahoo!?
Yahoo! Tax Center - forms, calculators, tips, more
http://taxes.yahoo.com/

  

Feedback to <mike@indexdata.com> is welcome!