[Previous by date - Re: Note 9.4.1]
[Next by date - Re: Animal 'bar codes' to take over from Latin names]
[Previous by subject - Re: Fw: languages in PhyloCode]
[Next by subject - Re: Fwd: Gender of species names?]
Date: Sun, 09 Mar 2003 09:22:11 -0800 (PST)
From: "Jaime A. Headden" <qilongia@yahoo.com>
To: List PhyloCode <PhyloCode@ouvaxa.cats.ohiou.edu>
Subject: Re: Fwd: Animal 'bar codes' to take over from Latin names
Posted from the Dinosaur Mailing List (my reply to follow): --- Ronald Orenstein <ornstn@rogers.com> wrote: > Well, this should be fun for palaeontologists.... > > > >-------------------------------------- > >Animal 'bar codes' to take over from Latin names > >By Roger Dobson, Independent.co.uk > >March 9 2003 > > > >The names don't exactly trip off the tongue. But the official Latin > >monikers used to catalogue the world's animal species are about to be > >replaced with the sort of bar code normally seen on a baked bean tin. > > > >For the past two and a half centuries, scientists examining new species > > >have allocated them to the right family with a description based on a > >Latin root making sure, of course, not to confuse an Arbitrarus > >conventicus with a Revisionus conventicus and also carefully > catalogued > >them according to their appearance. > > > >But there are fewer and fewer people able to do this work, and it is > also > >painfully slow. Over the past 250 years, only a modest 1.2 million > species > >have been described and named. With an estimated 10 million animal > species > >still to be recorded, there are fears that many could disappear before > >they are properly catalogued. > > > >Today 40 leading scientists involved in taxonomy the classification > of > >organisms will meet in New York with the aim of setting up an > >international bar-coding system using individual DNA as labels for new > >species. Existing species will get their own bar code, too. > > > >With the right technology, says a report co-authored by scientists at > the > >Natural History Museum, in London, up to 1,000 species a day could be > bar > >coded by just one institution. And that, say scientists, will make it > >possible to catalogue animal life on the planet within two decades, > 1,000 > >or so years sooner than under the current system. > > > >Scientists say that the retail industry's coding system employs 10 > digits > >to create 100 billion different combinations, or bar codes, that are in > > >turn allocated to specific products ranging from canned beans to > electronics. > > > >DNA is also encoded, using four chemical bases adenine (A), cytosine > >(C), guanine (G) and thymine (T) and the genomes of most species are > >millions of these nucleotides long. The sequence for every living > organism > >is different, and just using a fraction of the sequence would provide > more > >than one billion bar code options. > > > >Although new species may have a bar code only, existing species will > keep > >their Latin names too. The bar code for an African elephant (Loxodonta > >africana), for example, would be made up of thick and thin lines > >representing the four chemical bases using the letters > >AACACTGTATCTATTATTTG, while the domestic cat would be > TACTCTTTACCTTTTATTCG. > > > >"The proper naming of species has become a serious bottleneck," says > >Professor Paul Hebert, of the University of Guelph, in Canada, who will > be > >at today's meeting. "I do think it is a serious problem, and I believe > the > >move to DNA-based taxonomy will lead to a new approach to the > description > >of species. After the bar coding, those who then want to name and > describe > >species can come along over the next 2,000 years or so because that's > > >how long it would take and do so. What we are saying is that there is > a > >need to bring modern technology to the task of species recognition. We > >also suggest that nature has been kind enough to embed every life form > >with a 'bar code' and all we need to do is read it." > > > >Dr Richard Thomas, of the Natural History Museum, and co-author of a > >report published this week in Trends in Ecology and Evolution, said: > "We > >think DNA will be very useful for groups of species that have a lot of > >diversity in them. With the use of DNA, a species could be described > and > >catalogued. Some groups suggest that a DNA bar code would be > sufficient, > >but I believe that we would still want to come back and name them, > >possibly at a later date. > > > >"Another advantage of bar codes is that the information is digital and > not > >influenced by subjective assessments. It would be reproducible at any > time > >and by any person, speaking any language." > > > >The report reveals the speed with which bar coding illustrated above > in > >mock-up form for a polar bear and an African elephant could be done. > > > >The report states: "Establishment of a DNA facility that could > routinely > >handle 1,000 samples per day would cost approximately as much as a > >facility that runs a transmission and a scanning electron microscope. > The > >material costs for each sample, including DNA extraction and sequencing > of > >two independent regions, would be five euros per sample." > > > >Just what Darwin would make of it is not clear, but Dr Thomas believes > he > >would be in favour: "I think he would really love it," he said. > -- > Ronald I. Orenstein Phone: (905) 820-7886 > International Wildlife Coalition Fax/Modem: (905) 569-0116 > 1825 Shady Creek Court > Mississauga, Ontario, Canada L5L 3W2 mailto:ornstn@rogers.com And this is better how? Please, as for the subjectivity test, there are things called double-blind or Chinese Curtain tests, you know. How will this affect the nomenclature and reference struture of fossil species without DNA or taxa with incomplete DNA? I hope these guys know what the ramifications of their little system involves. I'll check out the current TREE at the college this afternoon. This should be most interesting.... Cheers, ===== Jaime A. Headden Little steps are often the hardest to take. We are too used to making leaps in the face of adversity, that a simple skip is so hard to do. We should all learn to walk soft, walk small, see the world around us rather than zoom by it. "Innocent, unbiased observation is a myth." --- P.B. Medawar (1969) __________________________________________________ Do you Yahoo!? Yahoo! Tax Center - forms, calculators, tips, more http://taxes.yahoo.com/